Binder Check

This is an ongoing list of the papers AND order of those papers for your binder check.

weekly schedule:

Date

Turned In

In Class

Homework

M
5.22

Exam Review

T
5.23
W
5.24
R
5.25
---
EXAMS
Have a great summer!


Date

Turned In

In Class

Homework

M
5.15

Human Impact Work Time
Public Service Announcements - THURSDAY
T
5.16

Human Impact Work Time

W
5.17

Human Impact Work Time
wevideo link

R
5.18

PSAs

F
5.19

Exam Review
Grade Corl


Date

Turned In

In Class

Homework

M
5.8
Human Impact Article Summary - shared with Corl or Schmidley
Human Impact Work Time
Topic Focus Questions; Hints for Success

T
5.9

Human Impact Work Time
Informative Presentations - TOMORROW
W
5.10
Human Impact Informative Presentation
Human Impact Presentations

R
5.11

Human Impact Presentations

F
5.12
Human Impact Presentation Notes
Human Impact Presentations
Semester 2 Exam Review



Date

Turned In

In Class

Homework

M
5.1

Human Impact Work Time

T
5.2

Human Impact Work Time
Project Check In

W
5.3

Greenhouse Effect
Bille Nye Climate Change Video
None Like it Hot

FOR THE WEBQUEST

NASA Climate Kids
U CAR Greenhouse Effect
Live Science Greenhouse Effect
IPCC Greenhouse Effect

R
5.4

Chasing Ice

F
5.5

Climate Change & Greenhouse Effect Quiz - on Schoology
EVOLUTION TESTS ANSWERS ARE UP - CHECK YOUR TEST!
Human Impact Work Time
Article Summaries - Electronically to Corl / Schmidley on MONDAY

Date

Turned In

In Class

Homework

M
4.24

Human Impact Divider

The Lorax


T
4.25

Human Impact Project Explanation


Research Databases (from the Library)
TedEd - lots of good informative video clips
Crash Course - good place to start!

PSA Examples:
Number 1
Number 2
Number 3
Number 4
Number 5
Number 6
Number 7
Article Summary: 5.8
Informative Presentation: 5.10
Public Service Announcement: 5.16
W
4.26
IN MEDIA CENTER

Human Impact Projects - Resources Explanation w/ Mrs. King

R
4.27

Human Impact Projects - Research
Project Topics Corl
EBSCO Advanced Search Directions
Topic Focus Questions; Hints for Success

F
4.28

Human Impact Projects - Research


Date

Turned In

In Class

Homework

M
4.17
---
Read Chapter 17 and answer questions 1-33 on pgs 507,-509
Chapter 17 work due by FRIDAY
T
4.18
(4.5, 7.8, 2, 10)
W
4.19
(9)

Planet Earth: Pole to Pole


W
4.19
(4.5, 7.8, 10)
R
4.20
(2)
F
4.21
(9)

Planet Earth: Pole to Pole

F
(4.5, 7.8, 10)
Chapter 17 Work
Pole to Pole WS
Use textbook (pages 65-73) to supplement tables.


Date

Getting Started

Turned In

In Class

Homework

M
4.10
(2, 4.5, 7.8)
T 4.11
(9, 10)


Finish Population Notes
Analyzing Population Graphs

Population Graphs - THURSDAY
T
4.11
(4.5, 7.8)
W
4.12
(2, 9)
Differentiate between energy and matter movement in an ecosystem.

Introduction to Classification



Three Domains of Life
What is a Protist?
How smart is slime?

W
4.12
(4.5, 7.8)
---

Work Time - Population Graphs

R
4.13
The state mammal of Ohio, the white-tailed deer, has the scientific name Odocoileus virginianus.
1. What two taxonomic levels does the scientific name refer to?
2. Which species is most closely related to the white-tailed deer? Why?
A. Lepus callotis
B. Bubo virginianus
C. Odocoileus hemionus
D. Colinus virginianus
Population Graphs

Getting Started (5 GS, 3 Video Notes)

Classification Group Work
Classification Worksheet Group Work

Amoeba Sisters Classification


Date
Getting Started
Turned In
In Class

Homework

M
4.3
Write down any questions you have about AIR Tests.
When is the Biology AIR Test?
---
AIR Test Practice
- Apps --> AIR Secure Test
- Select "Ohio"
- Select "Ohio's State Tests"
- Go to the training test site
- Sign in (as a guest)
- Select your Grade (9 or 10 -- doesn't matter!)
- Scroll to "Science"
- Complete Biology Practice Test AND Biology Spr16 Released Items on notebook paper -- label/title your sections and number the questions.

T
4.4
Write down 2-3 test taking strategies.

AIR Test Practice

W
4.5


AIR Test Practice
Check Answers and Score
Ohio AIR Test Practice Site (has BOTH Biology tests, and tests from other subjects, too!)
Practice Test & Scoring Sheet - FRIDAY
R
4.6
Crash Course Ecology w/ Biomes

Write down 5 facts from each crash course video.

Ecosystem Ecology Crash Course

Population Ecology Divider
Population Ecology Notes



F
4.7
Crash Course Population Ecology
AIR Test Pracitce w/ Scoring Sheet
Finish Notes


Date

Getting Started

Turned In

In Class

Homework

M
3.20
Cladogram AIR Question 3.jpg
Hardy - Weinberg Practice
Crash Course Population Genetics

Go Over Hardy-Weinberg


Crash Course Speciation
Projects DUE 3.22 WEDNESDAY

Evolution Test & Binder Check - THURSDAY 3.23 & FRIDAY 3.24



Bozeman Science Hardy Weinberg Help

Khan Academy H-W Help
T
3.21
Speciation AIR Question.jpg

Cosmos Episode 2: Some of the Things Molecules Do
Projects DUE TOMMORROW

Evolution Test & Binder Check - THURSDAY 3.23 & FRIDAY 3.24
W
3.22
History of Earth AIR Question.jpg
Getting Started (3GS and video notes)
Review Bingo
List of the Words
Evolution Test & Binder Check - TOMORROW 3.23 & FRIDAY 3.24
R
3.23
---
Binder
Test Day 1
FINISH EVOLUTION TEST TOMORROW
F
3.24
---

Test Day 2



Date

Getting Started

Turned In

In Class

Homework

M
3.13
In the natural selection PhET simulation (with the bunnies), you clicked the "Add Mutation" button to introduce genetic variation into the population. How is this different than when mutations occur in real organisms?
Extra Credit - by 3 pm
Cladograms
Cladogram Notes



Sci Show: Evolution Misconceptions
Projects DUE 3.22 (NEXT WEDNESDAY)

Evolution Test & Binder Check - THURSDAY 3.23 & FRIDAY 3.24

Make a Cladogram - WEDNESDAY
T
3.14
1. If an adaptation has no effect on fitness, will it change through natural selection? Explain why or why not.

2. An adaptation can change over the course of an organism’s life if the need to adapt arises. Explain whether this answer is true or false and why.

How Do Species Compare?
Introduction to Cytocrome C
Amino Acid Sequencing & Cladograms
Make a Cladogram - TOMORROW

Projects DUE 3.22 (NEXT WEDNESDAY)

Evolution Test & Binder Check - THURSDAY 3.23 & FRIDAY 3.24
W
3.15
Cladogram AIR Question.jpg

Genetics of Evolution
Wrap Up Amino Acid Sequencing
Sci Show: This is NOT What Evolution Looks Like
Projects DUE 3.22 (NEXT WEDNESDAY)

Evolution Test & Binder Check - THURSDAY 3.23 & FRIDAY 3.24
R
3.16
Cladogram AIR Question 2.jpg
How Do Species Compare?
Finish Genetics of Evolution Notes
Projects DUE 3.22 (NEXT WEDNESDAY)

Evolution Test & Binder Check - THURSDAY 3.23 & FRIDAY 3.24
F
3.17
Protein Sequence Evolution AIR Question.jpg
Allele Frequency AIR Question.jpg
Getting Started (8)
Hardy-Weinberg

Projects DUE 3.22 (NEXT WEDNESDAY)

Evolution Test & Binder Check - THURSDAY 3.23 & FRIDAY 3.24

Bozeman Science Hardy Weinberg Help

Khan Academy H-W Help

Date

Getting Started

Turned In

In Class

Homework

M
3.6
Amoeba Sisters Natural Selection
Write down 5 facts from the video.

Artificial vs Natural Selection
Evolution Through Natural Selection Notes
(Principles / NS through slide 19; Evidence through 34; History through 55)
Sources of Variation
What is Mutation?


Natural Selection: Seeing Clearly
Natural Selection in Action (Moths) - WEDNESDAY


Yet another video on the principles of natural selection...
Crash Course Natural Selection

Change Over Time Projects - WEDNESDAY 3.22
T
3.7


Finish Notes
Crash Course: Evidence for Evolution
Evidence for Evolution: Seeing Clearly
Natural Selection in Action due Thursday (Schmidley ONLY)
W
3.8
Predict what would happen to a population of plants if their environment experiences long-term climate change that results in a much hotter and drier environment.

A. The plants would increase the number of seeds they make to improve their chances of reproducing.
B. Individual plants would work harder to grow longer roots and thicker leaves to better survive the climate change.
C. The plants that gather and store water most efficiently would survive to pass on those traits.
D. All of the plants in the area would die before producing offspring.

Pick and letter and explain why this is the best answer in terms of natural selection.
Natural Selection in Action
Fill the Bill

Recipe for Evolution Interactive Presentation
R
3.9
---
Pt 1 of Quiz
Rock Pocket Mice: Evolution In Action
Things You May Not Know About Evolution: Addressing Misconceptions
Group Quiz w/ PhET Simulation - Part 1 & Start Part 2

F
3.10
---
Part 2 or Quiz
Group Quiz w/ PhET Simulation - Finish Part 2 (CER)

Who Wants to Live a Million Years Extra Credit - **DUE MONDAY!**


Date

Getting Started

Turned In

In Class

Homework

M
2.27
Describe the increase in oxygen in Earth's early atmosphere.
Include a description of where it came from and what influence that had on
Timeline Event
Start Making Timeline
Timeline Questions - THURSDAY

T
2.28
Based on the video, why was cephalization (development of a head) such an evolutionary benefit?

Finish Timeline & Notes

Change Over Time Project Explanation


W
3.1
Based on the video (and your knowledge of mitosis & meiosis), why was sexual reproduction such an evolutionary benefit?

Timeline Questions Work Time

Life Begins: Crash Course Big History #4
Driving Questions:
1. Conditions that made is possible for life to emerge on Earth (autotrophs & oxygen)
2. Major events in the development of life on Earth
3. Evidence to explain adaptation and evolution
Change Over Time Project Explanation

Change Over Time Projects - 3.22; Late projects @ 50%
R
3.2
1. What are the four main eras of time on Earth?
2. What life forms dominated these eras?
2. What events separated these eras? Should have 3.
Timeline Questions
Extinction! Video



F
3.3
What role does extinction play on evolution and evolutionary change?
Getting Started (5)
Evolution Vocabulary Activity - Creating Working Definitions
Vocabulary Words

Schmidley Period 2 Group Survey
Schmidley Period 2 Results
Schmidley Period 2 Definition

Schmidley Period 10 Group Survey
Schmidley Period 10 Results
Schmidley Period 10 Definition


Date

Turned In

In Class

Homework

T
2.21
Test - CER & Schoology
Finish Genetics Test

Work on Timeline Event
Timeline Event - FRIDAY (Picture on front; 2/3 sentence explanation on back)
BBC Nature: History of Life
Understanding Evolution
BBC Earth: 25 Biggest Turning Points in Earth's History

CINCH Reading: Origin of Life; Fossil Evidence of Change
W
2.22

Check Timeline Events - DID YOU SIGN ONE OUT YESTERDAY?!?!

Evolution Divider

History of Life Notes
The Evolution of the Cell

History of Life Slides Presentation
Timeline Event - FRIDAY

Forget which event you were? Check the link below!
Timeline Events Sign Out
R
2.23

Origin of Life

F
2.24
Video WS
Timeline Event
Finish Origin of Life
Wrap-Up History of Life Notes
Geologic Time Interactive


Date

Turned In

In Class

Homework

M
2.13
Karyotype Extra Credit by 2:15 - NO LATE ASSIGNMENTS ACCEPTED
What is the Epigenome?
Your DNA, the Environment and Epigenetics
Lick Your Rats: Epigenetics
Ghost in your Genes
Important Vocabulary Words:
- epigenetics
- genetic switches
- epigenome
- stem cells
- transgenerational effects
Test Thursday
T
2.14

Epistasis Traits
Epistasis

Epistasis, Pleiotropy & Polygenic Traits KEY
Test Thursday
W
2.15

Genetics Review
Pedigree Practice
Vocabulary Table *Updated*
Test Review (Handed out in class today)
Test TOMORROW
R
2.16

Genetics Test
---

Date

Getting Started

Turned In

In Class

Homework

M
2.6
In dogs, the allele for short hair is completely dominant over the allele for long hair. Two short-haired dogs are the parents of a litter of eight puppies. Six puppies have short hair, and two have long hair. What are the genotypes of the parents? Explain your answer.
---

Amoeba Sisters Beyond Complete Dominance

Finish Beyond Complete Dominance Punnett Squares
T
2.7
Explain the phenotypes seen in the heterozygotes of complete dominance, incomplete dominance and codominance.


Making and Reading Karyotypes
--> First Site
--> Scroll to More About Chromosomes
--> Click on Using Karyotypes to Diagnose Genetic Disorders
--> Karyotype Notion: total number of chromosomes, sex (in XX or XY); +/- chromosome number
--> Second Site

Karyotype Activity - FRIDAY
W
2.8
Looking at this karyotype, write the notion.

Sex-Linked Traits
Introduction to Molecule Genetics: Autosomes vs X Chromosomes vs Y Chromosomes


Finish Sex-Linked Traits - TOMORROW

Karyotype Extra Credit - MONDAY by 2:15 (no late assignments will be taken)


R
2.9
Colorblindness is a recessive, sex-linked disease.

Which child could NOT be born to these parents: a female carrier and a normal male? Pick a letter and tell me why.

a. color-blind daughter
b. color-blind son
c. daughter with normal vision
d. son with normal vision

Pedigrees & Sex-Linked Pedigrees


F
2.10
In a maternity ward, four babies become accidentally mixed up. The ABO phenotypes of the four babies are known to be O, A, B and AB. The ABO phenotypes of the four sets of parents are determined. Indicate which baby belongs to each set of parents:
a. AB x O
b. A x O
c. A x AB
d. O x O
Getting Started (9)

Karyotype Activity
Wrap-Up Pedigrees & Sex Linked

Corl - answers are up for your Cell Growth and Reproduction Tests --> REVIEW THEM TODAY
Extra Credit - MONDAY by 2:15 --> NO LATE ASSIGNMENTS

GENETICS TEST THURSDAY 2.16.17

Date

Getting Started

Turned In

In Class

Homework

M
1.30
In a gamete, how many copies of each gene are there?
---
Genetics Notes
Complete Dominance Practice - WEDNESDAY
T
1.31
Vocabulary Work
Google Doc of Vocabulary
Vocabulary in Table; Matched
Making Dragons
Finish Genetics Notes
Complete Dominance Practice Work Time
Finish Complete Dominance Practice

W
2.1
1. After receiving a piece of "taster" paper, put it in your mouth.
2. If you taste a bitter taste you are labeled a "taster". Record this on your getting started. Being a taster is a dominant trait (T = taster; t = non-taster)
3. Record class data.
4. Determine your possible genotype (write this on your getting started).
5. What would be the possible genotypes of your parents based on your genotype?
6. Using the gel below as reference, what would your DNA look like for PTC tasting?
PTC gel.JPG
---
Complete Dominance Group Work
Still struggling with basic inheritance patterns?
1. Read CINCH "Mendelian Genetics"
2. Multiple Choice Practice Questions
3. More Practice Problems
R
2.2
Mr. Smith and his wife recently had a child, but they are not sure they received the right child from the hospital. Mr. Smith is homozygous dominant for bushy eyebrows, while his wife is heterozygous for the trait. The baby they brought home has thin eyebrows. Did the hospital make a mistake? (Bushy eyebrows (B) is completely dominant to thin eyebrows (b))
---
Punnett Squares: Predicted vs Actual Ratios
Table for Class Data

UPDATED Spreadsheet

F
2.3
Answer both questions with a letter AND and explanation for WHY you chose the letter you did.

genetics ogt practice.JPG
genetics ogt practice.JPG

---
Dihybrid Crosses

Finish Dihybrids - MONDAY

Date

Getting Started

Turned In

In Class

Homework

M
1.23
Pretend you have a coin that is flipped, so the outcomes are heads or tails. Determine the possible outcomes when you flip this coin 1 time or 2 times or 3 times or 4 times.
Heads or Tails
AFTER DISCUSSION
Explain what this has to do with independent assortment and chromosomes.
Genetic Variation CER
Genetic Variation CER Wrap Up
Test and Binder Check WEDNESDAY
T
1.24
external image media%2F846%2F846ccfdf-d022-4c93-bf95-fbb6bb618b2a%2Fphp8CglPZ.png
1. How many "sets" of homologous chromosomes does this cell have? How can you tell?
2. What is the diploid (2N) number for this cell?
3. What would the haploid (N) number be for this cell?
4. Draw this cell after going through mitosis (include color and letters).
5. Draw this cell after going through meiosis (include color and letters).
6. Using math, how many ways can these chromosomes line up during metaphase I?
7. Assuming crossing over occurred at least once during Prophase I, how many different gene combinations would there be at the end of meiosis II?
Getting Started 1.24 Answer Key

Cell Cycle & Reproduction and Review

Test and Binder Check
TOMORROW
W
1.25
---
Test (Schoology)
CER question (paper)
NO BINDER CHECK

Cell Cycle & Reproduction Test

R
1.26
---

Science Course Offerings Discussion
What Science Class to Take?
AP vs IB vs CCP
Course Description Guide
Science Course Selection Paper - TOMORROW (Due to math class MONDAY)
F
1.27
In your own words, tell me what heredity is.
Getting Started (7)
Genetics Introduction
Making Dragons


Date

Getting Started

Turned In

In Class

Homework

T
1.17
new paper **

Create a table comparing binary fission, mitosis and meiosis in the type of cells that utilize the process and the purpose of the process.


Amoeba Sisters - Chromosome Numbers Demystified
- Take notes in note packet from Friday
Meiosis Webquest

- Site 1
- Site 2
- Site 3

Webquest - THURSDAY

W
1.18
chromsomes.jpg
What is the difference between the chromosomes on the left side of the arrow and the chromosomes on the right side of the arrow? What phases in the cell cycle would these chromosomes be in?

Ploidy Work
Webquest - TOMORROW

Test - TUESDAY 1.24
R
1.19
external image early_prophase.png
1. How many chromosomes does this cell have?
2. Are the chromosomes replicated or unreplicated?
3. How many sets of homologous chromosomes does this cell have? How do you know?
4. Is this cell haploid or diploid? How do you know?
5. What would the 2N number for this cell be?
6. What would the N number for this cell be?
7. If this cell went through mitosis, the ending daughter cells would each have how many chromosomes? Draw this cell at the end of mitosis.
8. If this cell went through meiosis, the ending daughter cells would each have how many chromosomes? Draw this cell at the end of meiosis.
Site 2 on Meiosis Webquest
Making Mitosis & Meiosis Work
Analysis Questions
Test - Next Tuesdat
F
1.20
Explain this picture in terms of meiosis. Mention words like chromosomes, diploid & haploid.
meiosis simple picture.JPG
meiosis simple picture.JPG

---
Genetic Variation CER
Test AND Binder Check - TUESDAY

Date

Getting Started

Turned In

In Class

Homework

M
1.9
Where are you most likely to find cells in the cell cycle? Why is this?
Cell Cycle & Mitosis Webquest
Mitosis Notes

Read CINCH "Cell Cycle Regulation" and answer questions 5, 7, 9, 10, 12, and 26 - by WEDNESDAY
T
1.10
external image images?q=tbn:ANd9GcTdD9XtbD9DifRCvg8V8rX0fbndzaLAH23JBRr3pNFB0Pgd-ZWd6GbC-Qh1
1. This cell is in which phase?
2. How many chromosomes will each daughter cell have at the end of cytokinesis?
3. Which phase comes after this?
4. Which phase comes before this?

Mitosis in a Blood Lily
Mitosis in Animal Cell
Finish Notes - Cancer
Mitosis ThingLink Project
ThingLink Group Signup

Picture Option #1
Picture Option #2
Picture Option #3
Picture Option #4
Picture Option #5
Picture Option #6
Read CINCH "Cell Cycle Regulation" and answer questions 5, 7, 9, 10, 12, and 26 - by WEDNESDAY
W
1.11
Whitefish MitosisThere are approximately 100 cells in this picture.
1. The majority of the cells are in what phase? Describe the key cellular/nuclear features.
2. Identify; label and describe the key nuclear features of the 5 cells going through mitosis (the ones with black/condensed chromosomes).
Cell Cycle Regulation Questions
Mitosis ThingLink Work Time

R
1.12
Describe how the centrioles, spindle fibers and centromeres are related.

Cancer and the Cell Cycle
Cancer Biology Animation
HHMI BioInteractive
Picture of p53 Tumor Suppressor Gene Sculpture in Norway
Jack Andraka: Test for Pancreatic Cancer
Gene Patenting
ThingLink link to google doc by TUESDAY at 3.
F
1.13
Why is it important that egg and sperm cells have half the DNA as somatic (body) cells?
Getting Started (8)
Meiosis Notes


Date

Getting Started

Turned In

In Class

Homework

W
1.4
What is surface area? What is volume? Describe both of these ideas in WORDS and, if you know it, the FORMULA (for a cube).
---
Change Seats
Cell Growth & Reproduction Divider

Why Are Cells So Small?


Change Out Divider Names:
1. Cell Growth and Reproduction
2. Genetics
3. Evolution
4. Population Ecology
5. Human Impact on the Environment
R
1.5
As a cell, would you want a larger or smaller surface area to volume ratio? Why?
Size of Cell Lab
Why Are Cells So Small?
Mitosis & Cell Cycle Webquest

http://www.biology.arizona.edu/cell_bio/tutorials/cell_cycle/main.html
https://www2.estrellamountain.edu/faculty/farabee/biobk/BioBookmito.html
http://www.biology.iupui.edu/biocourses/N100/2k4ch8mitosisnotes.html
Webquest - MONDAY
F
1.6
Crash Course Mitosis
Amoeba Sisters Mitosis

Record 5 facts from the video on your getting started.

Evolution Pre-Test P2
Evolution Pre-Test P45
Evolution Pre-Test P78
Evolution Pre-Test P9
Webquest Work Time
Webquest Monday


Date

Turned In

In Class

Homework

M
12.12
---
Wrap-Up Plant Mass Lab (Corl)
Cellular Respiration Notes
Exam Cheat Sheet
Corl - Binder Check --> ON EXAM DAY
T
12.13

Snail Lab - Day 1
--> up to "Day 2" table
Exam Cheat Sheet
W
12.14

Snail Lab - Day 2
Exam Cheat Sheet
R
12.15

CINCH answer key
Cellular Energy Cycle Review --> Concept Map
Exam Cheat Sheet
F
12.16

Exam Cheat Sheet Work Time
EXAMS - MONDAY (2, 4.5); TUESDAY (10); WEDNESDAY (7.8, 9)
Corl - Binder Check --> ON EXAM DAY

Date

Getting Started

Turned In

In Class

Homework

M
12.5
Crash Course Photosynthesis
Record 5 facts from the video.
---
CINCH: How Organisms Obtain Energy & Metabolism

Finish CINCH Worksheet
T
12.6
SCHMIDLEY
Video: Life in Hydrothermal Vents (Chemosynthesis)

What is the difference between an anabolic process and a catabolic process?
Identify the following processes as anabolic or catabolic: photosynthesis, chemosynthesis, cellular respiration
CINCH Reading
Photosynthesis Notes & Seeing the Light
Amoeba Sisters: Photosynthesis

T
12.6
CORL
What is the difference between an anabolic process and a catabolic process?
Identify the following processes as anabolic or catabolic: photosynthesis, chemosynthesis, cellular respiration
CINCH Reading
What Factors Influence Photosynthesis? WORKSHEET
Gizmo Link




- Working with the person sitting next to you, complete this gizmo. You will need to make a copy of it in your drive to be able to write anything in it.
- As you are adding your answers; put this in a different color than the text in the document.
- You will be expected to share out your CER and graph Thursday at the beginning of class.
CER argument and graph - THURSDAY
W
12.7
1. What type of organism goes through photosynthesis?
2. Which organelle does photosynthesis take place in?
3. What is the goal/purpose of photosynthesis?

What Factors Influence Photosynthesis?
CORL - photosynthesis notes
Schmidley - Gizmo Class Document
What factors influence photosynthesis - TOMORROW
R
12.8
How do anabolic processes and catabolic processes store and release energy?

Amoeba Sisters Photosynthesis

Wrap Up Gizmo
--> As one large group, place your information (Conclusion & Sketch of graph) on a white board.

Challenge: Using the Gizmo, answer the question "How does colored light influence the rate of photosynthesis?"

F
12.9
external image Photosynthesis.gif
external image Photosynthesis.gif

Where does the mass come from in a plant?
A. Sun
B. Soil / minerals
C. Air (carbon dioxide)
D. Chloroplast
E. Water
F. Tree Generates Own Mass

Pick and support with reasoning.
CORL - Photosynthesis Gizmo

Getting Started (9)
Plant Mass Lab

Veritassium Video

MIT Students Mass of Tree
Where Does the Mass in a Plant Come From? - MONDAY

Date

Getting Started

Turned In

In Class

Homework

M
11.28
Reading the Codon Chart with start and stop
---
Change Seats (Corl)
Protein Synthesis Practice
Start & Stop Codons
Amoeba Sisters Protein Synthesis
Protein Synthesis with Start and Stop
Read CINCH "Gene Regulation and Mutations" -(just the section on mutations)
--> Using this piece of DNA (
TTTCACGAC) show how you can have both a silent mutation and a mutation that changes the protein. WEDNESDAY
T
11.29
Transcribe and translate this gene (section of codign DNA) into an amino acid sequence. Make sure to look for a start and stop codon!

GTACGCCTATACCGACATCCGA

Amoeba Sisters Mutations
Mutations: The Good, The Bad, The Nothing

CINCH Reading & Mutation HW (see MONDAY)
W
11.30
Protein Synthesis Practice AIR Question

Gel Electrophoresis How To

Restriction Enzymes in Action

Gel Electrophoresis

R
12.1
1. What do restriction enzymes do?
2. How do RFLPs (pieces of DNA) get separated by the agarose gel and the electrophoresis process?
3. Looking at the gel below, who is most likely the father of Mary's child - Bob or Larry? Explain your answer.
external image paternityTestFig3.gif
Mutation HW

Gel Electrophoresis CER
Gel Electrophoresis - CER Share Out

F
12.2
What is the most effective way for you to use the textbook?
Outlines? Notes? Quizzes? Worksheets? Questions from readings?

CINCH: How Organisms Obtain Energy & Metabolism



Date

Getting Started

Turned In

In Class

Homework

M
11.21
Figure 12.1.JPG
1. What is X? What three parts make up X?
2. What do the dotted lines represent?
3. What is the purpose of this molecule?
Getting Started (6)

Front Page of Reading Codon Chart (Pfeff Check)
TO DO:
1. Protein Synthesis Race Simulation --> emailed (corls@wcsoh.org OR schmidlm@wcsoh.org) answers by TUESDAY at 3 pm
Need at least an 80% for credit.
2. Coloring/Labeling Back Page of Codon Chart
3. Check Gizmo Answer Key

Study for Quiz
Transcription/Translation Practice
Second Page of Reading Codon Chart (Coloring) - TOMORROW
T
11.22
CHECK GRADED PAPERS FOLDER --> put your papers back in the right order! (What's the right order you ask? Check the link to your binder check!)
Reading the Codon Chart
FRONT - checked by Pfeff
BACK - coloring OR emailed simulation score
DNA Processes Group Quiz
1. DNA Structure
2. DNA Replication
3. Protein Synthesis


Date
Getting Started
Turned In
In Class
Homework
M
11.14
DNA Replication In Real Life
Why would a multicellular eukaryotic organism need to undergo DNA replication (make a copy of its DNA)? List as many reasons as you can.
---
1. Finish DNA Structure and Replication Worksheet
2. See Schmidley/Corl to check answer key

3. Begin working on DNA ThingLink Project (Due Wednesday)
DNA ThingLink Project (THURSDAY)

Extra Credit - FRIDAY
T
11.15
Steps of Replication w/ Manipulatives
---
DNA Replication Notes


ThingLink Work Time (Rubric )

Link to Class Share (ThingLink Turn In)
DNA ThingLink - THURSDAY
W
11.6
---
---
Assembly Schedule

ThingLink Work Time

DNA to Proteins w/ Gizmo Simulation
Class Codes (your login from the homeostasis simulation should be the same thing!)
CORL P2 = WGKJCDPRDC
CORL P45 = JDH3QWGT98
CORL P78 = GKRMNLCFWC
CORL P9 = LG7ZPVJVKQ
DNA ThingLink - BEGINNING OF THE PERIOD TOMORROW
R
11.17
Practice AIR DNA Replication.png
DNA ThingLink (turn in here)
TO DO LIST:

1. ThingLink Peer Review (link must be on table--> entrance ticket). When done with review; give it to the person so they can use it to fix their ThingLink by SUNDAY AT MIDNIGHT!

2. DNA to Proteins w/ Gizmo Simulation --> Corl has the answer key; check when done

3. Reading the Codon Chart: watch this video and using this animation try to complete the "reading the codon chart" activity --> If you get frustrated or lost try the coloring on the back!
Gizmo Simulation - BEGINNING OF THE PERIOD TOMORROW

Extra Credit - Photo 51 - TOMORROW
F
11.18
Crash Course Protein Synthesis

Take notes while watching this crash course. You need at least 9 bullet points of information!
Check Protein Synthesis Gizmo

Extra Credit
Protein Synthesis Notes

Reading the Codon Chart Practice
Codon Chart Practice - front page = MONDAY; back page = TUESDAY

Protein Synthesis Simulation --> emailed (corls@wcsoh.org OR schmidlm@wcsoh.org) answers by TUESDAY at 3 pm
Need at least an 80% for credit.

Date
Getting Started
Turned In
In Class
Homework
M
11.7
---
Group Egg Lab
- Group Egg Lab Work & Paper

- Discovering DNA Structure
Using the following sites, pdf, or your own google search and the puzzle pieces (with the "code" on the board) determine the structure of DNA.
SITES:
Genetic Home Reference
How Stuff Works; DNA Structure
Primary Molecular Structure of DNA
Nobel Prize - Matching DNA Bases Game

Read CINCH DNA:The Genetic Material --> Take notes; quiz on FRIDAY (you may use notes for quiz). Focus on these essential questions:
2. What is the basic structure of DNA?
3. What is the basic structure of eukaryotic chromosomes?
W
11.9
Sketch this picture of a nucleotide and label the three parts. What are the four nucleotides found in DNA?
Schmidley's Picture of a Nucleotide.PNG

DNA Structure w/ Kits

CINCH Reading (See assignment from Monday's HW)
R
11.10
If a strand of DNA has 25 base pairs, and a total of 12 thymine nucleotides, how many adenine, cytosine, and guanine nucleotides are there?

DNA Discovery & Structure Notes

DNA Presentation

F
11.11
Amoeba Sisters DNA Structure Review

CINCH Quiz - DNA Structure & Discovery
CORL P2
CORL P45
CORL P78
CORL P9
Structure WS (Corl Only)
To-Do List:
1. CINCH Quiz
2. Finish DNA Structure w/ Puzzles (Corl turn this in today!)
3. DNA Structure & Replication Worksheet - DUE TUESDAY (will have time to work on this on Monday)
Link to Animation

DNA Replication
DNA Replication In Real Life
Crash Course DNA Structure & Replication

CINCH Quiz: DNA
--Schmidley Period 2
--Schmidley Period 10
Secret of Photo 51 (start at 14:30)

(just page 2) by FRIDAY 11.18!

Date

Getting Started

Turned In

In Class

Homework

M
10.31
What is your favorite past Halloween costume?

Cell Organelle Matching Practice
---
Tonicity and the Cell

Osmosis Practice
CINCH - Cellular Transport - Read & Take Notes; Answer ?s 1, 2, 3, 8, 9, 12 & 16 - TOMORROW

Unit 3 Test - FRIDAY
Binder Check - optional

Egg Lab (Data) - THURSDAY
T
11.1
1. What type of solution is this cell in?
2.How do you know this?
3. What does the water movement look like?
4. How is the cell going to change?
5. What happens to the movement of water once equilibrium is reached?
Tonicity GS.jpg
CINCH Cellular Transport Questions
Endocytosis & Exocytosis
--> Scientific Candy Eating

Moving Materials Across the Membrane


Egg Lab - THURSDAY
W
11.2
There are three reasons cells must use energy to transport materials across the cell. What are those three reasons?

Homeostatsis Simulation
Link to Simulation
Sodium-Potassium Pump Video

Class Codes:
CORL P2 = WGKJCDPRDC
CORL P45 = JDH3QWGT98
CORL P78 = GKRMNLCFWC
CORL P9 = LG7ZPVJVKQ
Egg Lab - TOMORROW
*Check the board for hints when filling out the CER section on the analysis questions*

Test - FRIDAY
*Be looking over your "I Can" statements - this is your study guide*
R
11.3
Need a Chromebook

Check Graded Papers Folder

1. Get out your "I Can Statements"
2. Number them
3. As your numbering them, record which numbers you would like me to review on your getting started.
Getting Started (8)

Egg Lab
To-Do List (first 20 minutes or so):

1. Do today's getting started. Make sure you have 8 getting starteds - you will turn these in at the end of the period.
2. Turn Egg Lab In
3. Simulation Answer Key
4. Kahoot

Unit 3 Test Review
Test TOMORROW - Need more review?
Endosymbiotic Theory Animation
Crash Course Animal Cells
Crash Course Plant Cells
Crash Course Membrane & Transport
Amoeba Sisters Cell Membrane & Transport
Amoeba Sisters Osmosis
Bozeman Science Cell Organelles
Bozeman Science Cell Membrane Structure
Bozeman Science Cellular Transport

Optional Binder Check TOMORROW
F
11.4

Test
Binder (optional)
Unit 3 Test


Date

Getting Started

Turned In

In Class

Homework

M
10.24
1. What is a cell membrane?
2. List 2 jobs or functions it does for the cell.
3. What characteristics would it have to have in order to perform these functions?
Organelle Project by 3pm
Egg Lab Day 1
Endosymbiotic Theory Questions (6-10 on Theory Questions) - THURSDAY

T
10.25
Cell Matching
---
Cell Membrane Notes


Theory Questions - THURSDAY (Friday for Schmidley's classes)
W
10.26
1. What is homeostasis?
2. Why is it so important?
3. How does the cell membrane maintain homeostasis?

Egg Lab Day 2

Cell Defense: The Plasma Membrane
Theory Questions - TOMORROW (Friday for Schmidley's classes)
R
10.27
Why is it important the cell membrane is semipermeable?
Theory Questions
Egg Lab Day 3

Continue Cell Defense: The Plasma Membrane

F
10.28
List as many words as you can that start with the prefixes hyper, hypo and iso that you can. From your list, try to define what these prefixes mean.
Cell Membrane Simulation - by end of period
1. Egg Lab Day 4 (Data)
2. Pick up graded papers & put them in binder
3. Wrap Up Cell Membrane Simulation - TURN IN
4. CINCH Reading & Questions
5. Egg Lab Graph - don't forget to label your axes, put units, a title and a key/legend - need two lines: your data and class data --> answer analysis questions off of CLASS data
Egg Lab - WEDNESDAY
Unit 3 Test - FRIDAY 11.4.16

Read CINCH "Cellular Transport" - Take Notes & Answer the review questions 1, 2, 3, 8, 9, 12, and 16 - TUESDAY

Date

Getting Started

Turned In

In Class

Homework

M
10.17
Create a venn diagram (or just list) comparing prokaryotes to eukaryotes with the following criteria:
5 similarities
2 differences (each)
---
Cell Structure & Function Lab
Organelle Project - MONDAY 10.24
Lab - end of the period TOMORROW
T
10.18
Create a venn diagram (or just list) 3 similarities and 3 differences between animal and plant cells.

Finish Lab
First Quarter Check In

Cell Structure and Function Key
Organelle Project - MONDAY 10.24

Lab - TOMORROW
W
10.19
Explain what the phrase "cells are the basic unit of structure and function" means in your own words.
Cell Structure & Function Lab
Development of the Cell Theory


Wacky History of Cell Theory
Organelle Project - MONDAY 10.24
R
10.20
Nearpod Quiz: Write your score (out of 15).
Getting Started (7)
Nearpod w/ Cell Theory
--> Enter code on the board


Ahead of the game? Get started on questions 6-10!

Organelle Project - MONDAY 10.24

Date

Getting Started

Turned In

In Class

Homework

M
10.10
---
Test
Binder
Biochemistry Test
Effect of Variables on an Enzyme - WHOLE PAPER (even #8) - TOMORROW
T
10.11
---
Effect of Variables on an Enzyme
Cell Structure & Function Packet Work Day
-->Crash Course:
Crash Course - Animal Cells
Crash Course - Plant Cells
-->Biology HippoCampus Cell Parts Review
-NROC Collection: Biology
-Scroll down to "Cellular Organization"
--> CINCH Reading: Cell Structures & Organelles

Not the exact same packet, but the links are the same!


Link #2 in the Review
Cell Structure & Function Review Packet - FRIDAY
W
10.12
new paper

What does it mean to be alive? What characteristics do living things have?

Cell Processes Divider

Characteristics of Life


Characteristics of Life - TOMORROW
R
10.13
Which characteristic of life is more important to the group of organisms than to each individual? Why?
Characteristics of Life Check --> Stamp from Corl
Introduce Organelle Project
Packet & Project Work Time
Organelle Project - October 24

Cell Structure & Function Packet - TOMORROW
F
10.14
Which organelle would be most used in the following parts of an organism? and WHY?
1. muscle cell
2. skin cell
3. top of a leaf cell
4. immune system cell
5. blood cell
Cell Structure & Function Packet
Organelle Project Work Day
Organelle Project - October 24

Date

Getting Started

Turned In

In Class

Homework

M
10.3
What is the relationship between a monomer and polymer? Give an analogy not used in class.
Macromolecule Lab
Unknown Solution Testing (Part Five)

Finish Enzyme Packet - TOMORROW

Biochemistry Test & Binder Check - FRIDAY
T
10.4
1. What is a macromolecule?
2. List the monomer for each of the macromolecules (polymers) - there are 4 of them.
3. List the main functions of each of the macromolecules.

Unknown Solution Testing Day 2

Build an Atom Key


W
10.5
Enzyme Video #3

Getting Started 10.5.16

Effects of Variables on Enzyme Activity
Enzyme Simulation

Messing with Enzymes - FRIDAY
R
10.6
Describe how enzymes work.

active site
activation energy
speed of reaction
substrate
product

Enzyme Activity Day 2 --> Share Out
Corl Period 2 Graphs
Corl Period 45 Graphs
Corl Period 78 Graphs
Corl Period 9 Graphs

Instructions for Schmidley's Class

F
10.7
What are things (at least 2) that you do to study/review material?
Getting Started (7)
Review for Biochemistry Test
Schmidley Period 2 Graphs
Schmidley Period 10 Graphs
Test MONDAY

Effects of Variables on Enzyme Activity - TUESDAY

Date

Getting Started

Turned In

In Class

Homework

M
9.26
Describe how the positive and negative parts of a water molecule are made. What properties of water does this create?
---
Finish Macromolecule Notes


Read CINCH Polymers; Proteins; Carbohydrates; Lipids; Nucleic Acids by WEDNESDAY and create an outline of the reading - may use this on the reading quiz!
How To Create an Outline
Video: How To Outline
How To Make an Effective Outline

Acids and Bases Lab - TOMORROW

"Fixed" binders by WEDNESDAY (Corl only)
T
9.27
Pre-Lab Questions
Acids & Bases Lab
Macromolecule Lab Day 1

Online Macromolecule Testing Simulation
"Fixed" binders by TOMORROW (Corl only)

Outline - TOMORROW
W
9.28
CINCH Reading Check
Macromolecule Outine from CINCH

"Fixed" Binders (Corl only)
CINCH Reading Check
Corl Period 2
Corl Period 45
Corl Period 78
Corl Period 9
Schmidley Period 2
Schmidley Period 10

Macromolecule Lab Day 2
Macromolecule Lab - MONDAY
R
9.29
Enzyme Videos

Enzymes - A Fun Introduction

Functions of Enzymes
Write down 5 facts from each video (so 10 total)
---
Enzymes Background & CER


Want to watch more on enzymes?
PacMan & Enzymes

Still don't get these macromolecules?
Crash Course Macromolecules
Amoeba Sisters Biomolecules
Finish Macromolecule (everything but part 5) - MONDAY

Enzyme Worksheet - TUESDAY

Date

Getting Started

Turned In

In Class

Homework

M
9.19
Why would we start our study of biology with chemistry?
---
Finish Up Water Lab (Evidence Portion)
CINCH - Water & Solutions - TOMORROW
T
9.20
PICK UP YOUR BINDERS

Surface Tension
Describe why water is behaving like this. Use the words cohesion and adhesion.
Water Lab
Crash Course Water
Reasoning Portion of Water Lab
- Water & Solutions
- Types of Bonds
- Polar vs Nonpolar
- Water and Life
CINCH - Atoms, Elements, Compounds - THURSDAY

W
9.21
Describe the idea of "like dissolves like".

Build an Atom
pHet Simulation: Build an Atom
- Click on "HTML 5" if you have chrome book.
- Click the "play" button otherwise.
- pHet Build an Atom Worksheet
CINCH - Atoms, Elements, Compounds - TOMORROW
Build an Atom - FRIDAY
R
9.22
external image oxygen.jpg
1. What element is this? How do you know?
2. What would the mass of this element be?
3. What would the net charge be?

BONUS QUESTIONS (sophomores you should know this!)
4. In an ionic bond, this element will lose/gain electrons. (Pick one)
5. Because of my answer to #4, the oxidation number for this element is __.

Check Chemistry Review HW

Biochemistry Notes Part 1


Crash Course Carbon
Build an Atom - TOMORROW
Read Through A&B Lab - TOMORROW
F
9.23
The pH of stomach acid is around 2, while the pH of saliva is around 6. How much more acidic is the stomach acid than the saliva?

Remember pH is a LOGARITHMIC scale!
Build an Atom
Getting Started (7)
Acids & Bases Lab

Online pH Simulation
Read CINCH Polymers; Proteins; Carbohydrates; Lipids; Nucleic Acids by WEDNESDAY and create an outline of the reading - may use this on the reading quiz!
How To Create an Outline
Video: How To Outline
How To Make an Effective Outline
Analysis Questions A&B Lab - TUESDAY

Date

Getting Started

Turned In

In Class

Homework

M
9.12
John Oliver Clip
While watching the following clip, answer these 5 questions:
1. What does it mean to be skeptical?
2. What is the difference between exploratory and replication studies?
3. How do popular culture and the media influence communication of scientific research?
4. How does bias influence scientific research? (Bias = commitment to one viewpoint, ignoring other viewpoints that contradict it).
5. Why is sample size important in scientific research?
---
Nature of Science Notes


Finish reading and highlighting/underlining Nature of Science reference paper - TOMORROW

Unit One Test - THURSDAY
T
9.13
Get your graded papers from your folder!

Science is considered both reliable and tentative.
1. Explain how these opposite ideas can both hold true.
2. Is this a strength of science or a weakness? Why?

Finish Nature of Science Notes (Law vs Theory)
Nature of Science "Homework" (In Class --> Practice)

Check Graphing Practice

Finish John Oliver Questions by FRIDAY

TEST THURSDAY

Binder Check - THURSDAY
W
9.14
---

Go Over Binder Check #1 (Check list at top of wiki page for papers AND order)
Worktime: Nature of Science Homework
In-Class Review Practice Questions
BINDER CHECK & TEST TOMORROW
R
9.15
---
Binder
Test
Unit One Test
CINCH - Water and Solutions by MONDAY
F
9.16
Getting Started Video
Explain (as best as you can) how the product in the video works.

ON WATER LABS
---

Water Lab Day 1

CINCH - Water and Solutions by TUESDAY

Date

Getting Started

Turned In

In Class

Homework

T
9.6
Did the introduction of screening for breast cancer reduce the mortality rate? Create a CER argument based on the following graph.
external image fig1_tcm77-328810.png

Wrap-Up Dust Bowl

W
9.7
1. Describe academic honesty for me.
2. Tell me why you took honors biology (as opposed to regular biology)?

Experimental Design & Graphing


Experimental Design & Graphing Practice - FRIDAY
R
9.8
A scientist conducted an experiment to determine the effect of environment on the color of fur of a Himalayan rabbit. The Himalayan rabbit typically has a white coat except for its colder nose, feet, tail, and ears, which are black. The scientist shaved an area of hair on the back of each rabbit, then placed an ice pack over the shaved area on one rabbit (A). A picture of the set-up follows.
Himmalayan Rabbits.JPG
Himmalayan Rabbits.JPG

1. What is the independent variable?
2. What is the dependent variable?
3. What is the control?
4. Name 3 constants for the experiment.
5. What would the title for the experiment be? (FORM!)
6. Write the hypothesis the scientist is trying to test. (FORM!)

Digital Graphing Practice

F
9.9
Write 3 observations and 2 inferences based on one of the following pictures.
Getting Started (7)
Experimental Design & Graphing Practice
More Digital Graphing Practice


Date

Getting Started

Turned In

In Class

Homework

M
8.29
---

Pre Test

T
8.30
Your friend is struggling with using a microscope. Give them 2 or 3 pieces of advice for focusing on an image.

Wrap Up Microscope Labs

W
8.31
What does it mean to be accurate? What does it mean to be precise? Are they synonyms?
Microscope Labs
Measurement In Biology: Conversions & Precision



R
9.1
1. Which ruler is more accurate?
2. What is the length of ruler D?
3. What is the length of ruler E?
4. If ruler E is measured in centimeters, how many inches would it be? (2.54 cm = 1 in)
Precision 3.PNG

Surviving the Dust Bowl


F
9.2
---

CINCH Reading Quiz
Surviving the Dust Bowl
Dust Bowl Arguments by TUESDAY

Date

Getting Started

Turned In

In Class

Homework

M
8.22

---
Safety Search & Notes

Crash Course Safety

T
8.23

Safety Signature Sheet
Mystery Boxes

W
8.24


Penny Lab


R
8.25


Microscope Notes

Start Microscope Lab



F
8.26


Microscope lab


Date

Getting Started

Turned In

In Class

Homework

R
8.18
These will start Monday
Wright Family
Syllabus


Safety Pages


Wright Family
Safety Signature Sheet - TUESDAY
F
8.19
These will start Monday

Toilet Paper Introductions
Safety Signature Sheet - TUESDAY